xmlui.ArtifactBrowser.AdvancedSearch.title

Show simple item record

dc.contributor.authorLiza Rodríguez, Jacqueline Susann
dc.date.accessioned2013-08-20T20:46:10Z
dc.date.available2013-08-20T20:46:10Z
dc.date.issued2006
dc.identifier.urihttps://hdl.handle.net/20.500.12672/685
dc.description.abstractCon la finalidad de estandarizar una prueba para la determinación del sexo en guacamayos se procedió a extraer de 25 – 50 ng. de ADN genómico de sangre de 31 aves previamente sexadas, pertenecientes a 5 especies de guacamayos (Ara ararauna, Ara chloropthera, Ara macao, Ara militaris y Propyrrhura couloni) provenientes del Patronato del Parque de Las Leyendas (PATPAL) y de un zoocriadero privado, mediante un kit de extracción de ADN (Wizard ® Promega). El método empleado fue la técnica del PCR la cual amplificó un fragmento del gen CHD del cromosoma W presente solo en aves hembras (CHD-W), utilizando a los cebadores P2 (5´- TCTGCATCGCTAAATCCTTT - 3´) y P8 (5´- CTCCCAAGGATGAGRAAAYTG – 3´ R igual A / G, Y igual T / C) capaces de amplificar regiones no conservadas (intrones) de este gen, lo cual lo diferencia de su gen homólogo presente en los machos (CHD-Z). La amplificación se llevó a cabo tras la optimización de las condiciones y los ciclos termales, partiendo de las condiciones descritas por Griffiths et al., (1998). Los productos obtenidos fueron separados en gel de agarosa al 3% (Promega) utilizando un sistema de electroforesis horizontal (Hybaid) y visualizados mediante fluorescencia con bromuro de etidio a través de la luz ultravioleta, con lo cual se pudo observar 2 fragmentos en aves hembras y 1 fragmento en aves machos, estos fragmentos estuvieron comprendidos entre 300 - 400 bps. En este grupo se logró sexar a las 31(100%) aves y se obtuvo un 100% de compatibilidad entre los resultados obtenidos por métodos convencionales y por análisis de ADN. Posteriormente se procedió a sexar 28 guacamayos sin sexo conocido, bajo las condiciones anteriormente descritas, lográndose determinar el sexo de estas. Palabras Claves: gen CHD; Cebadores P2 y P8; Guacamayos; Sexo.
dc.description.abstract--- With the purpose of standardizing a test for the determination of the sex in macaws we proceeded to extract of 25-50 ng. of genomic DNA from the blood of 31 birds previously sexed, belonging to 5 species of macaws (Ara ararauna, Ara chloropthera, Ara macao, Ara militaris and Propyrrhura couloni) coming from the Patronato del Parque de Las Leyendas Zoo and a private center, using an extraction kit of DNA (Wizard ® Promega). The used method was the technique of the PCR which amplified a fragment of the CHD gene of the female exclusive chromosome W (CHD-W), using the P2 (5´- TCTGCATCGCTAAATCCTTT - 3´) and P8 (5´- CTCCCAAGGATGAGRAAAYTG-3´ R same A / G, Y same T / C) primers, which are able to amplify not conserved regions (introns) of this gene. This differentiates it of its male homologous gene (CHD-Z). The amplification was carried by the optimization of the conditions and the thermal cycles. It was based on the conditions described by Griffiths et al. (1998). The obtained products were separated in agarosa gel to 3% (Promega) using a horizontal electrophoresis system (Hybaid) and visualized by fluorescence with etidio bromide through the ultraviolet light. Then we can see 2 fragments in female birds and only one in male birds, these fragments were between 300 - 400 bps. In this group 31(100 %) birds were sexing and we obtain 100% of compatibility between the conventional methods and DNA analysis. Finally, with the conditions previously described we sex 28 macaws with unkowned sex Key Words: CHD gene; P2 and P8 Primers; Macaws; Sex.
dc.description.uriTesis
dc.language.isospa
dc.publisherUniversidad Nacional Mayor de San Marcos
dc.rightsinfo:eu-repo/semantics/openAccess
dc.rights.urihttps://creativecommons.org/licenses/by-nc-sa/4.0/
dc.sourceUniversidad Nacional Mayor de San Marcos
dc.sourceRepositorio de Tesis - UNMSM
dc.subjectGuacamayos
dc.subjectADN - Análisis
dc.titleDeterminación del sexo en guacamayos de las especies Ara ararauna, Ara macao, Ara chloropthera, Ara militaris, Propyrrhura couloni mediante el uso del ADN
dc.typeinfo:eu-repo/semantics/bachelorThesis
thesis.degree.nameMédico Veterinario
thesis.degree.grantorUniversidad Nacional Mayor de San Marcos. Facultad de Medicina Veterinaria. Escuela Académico Profesional de Medicina Veterinaria
thesis.degree.disciplineMedicina Veterinaria
dc.subject.ocdehttps://purl.org/pe-repo/ocde/ford#4.03.01
dc.publisher.countryPE
renati.levelhttps://purl.org/pe-repo/renati/level#tituloProfesional
renati.typehttps://purl.org/pe-repo/renati/type#tesis


Files in this item

Thumbnail

This item appears in the following Collection(s)

Show simple item record

info:eu-repo/semantics/openAccess
Except where otherwise noted, this item's license is described as info:eu-repo/semantics/openAccess